mRNAs (messenger RNAs) are an emerging class of therapeutic agents for the prevention and treatment of a wide range of diseases. As the world's leading manufacturer of custom mRNA synthesis, CD Formulation is committed to providing high-quality nucleic acid products and custom synthesis services for molecular biology research, diagnostics, and therapeutic applications. Leveraging a robust technology platform, state-of-the-art cGMP-grade manufacturing facilities, and cutting-edge mRNA synthesis technology, we offer custom mRNA synthesis services ranging from micrograms to hundreds of grams for customers worldwide.

Advantages of mRNA as Nucleic Acid Formulation

mRNAs play a pivotal role in the development of novel therapeutics and vaccines. mRNA molecules encode specific proteins and trigger targeted cellular responses, making them versatile tools for biomedical research and clinical applications.

Fig.1 Advantages of mRNA as Nucleic Acid Formulation. (CD Formulation)

Explore Our Custom mRNA Synthesis Services

CD Formulation is a recognized leader in the biotechnology industry, offering a comprehensive range of custom mRNA synthesis services and delivering innovative solutions to meet the varied requirements of researchers, pharmaceutical companies, and biotechnology firms.

Our Workflow for mRNA Synthesis

CD Formulation's mRNA synthesis services are supported by state-of-the-art solutions that guarantee the accuracy, scalability, and efficiency of custom mRNA molecule production. We employ advanced technologies and rigorous quality control measures to cater to the diverse needs of our clients.

Fig. 2 In Vitro Transcribed (IVT) mRNA Production. (Linares-Fernández S. et al., 2020)

mRNA Design

mRNAs are designed to achieve specific goals (including expression, delivery and stability of target proteins, immunogenicity, etc.), such as the production of specific proteins or the activation of an immune response. Our extensive experience in mRNA design allows us to meet the requirements of customers.

Manufacturing of mRNA

For mRNA synthesis, we normally use in vitro transcription (IVT) technology. The main process of preparation is as follows.

Using DNA containing the sequence of T7 promoter (TAATACGACTCACTATAGGG) or SP6 promoter (ATTTAGGTGACACTATAG) as a template, mRNA molecules complementary to one strand of the template DNA are synthesized using NTP as a substrate in the presence of T7 or SP6 RNA polymerase. Finally, the stability of the mRNA can be enhanced by adding a cap structure at the 5' end or a poly(A) tail at the 3' end.

mRNA Purification

After rigorous synthesis and modification, the resulting mRNA needs to be further purified to meet purity standards for subsequent studies. CD Formulation offers specialized purification technologies that remove excess immunostimulatory contaminants, free ribonucleotides, short mRNAs, and DNA templates.

Our Small Nucleic Acid Preparation Technology

Why Choose Us for Custom mRNA Synthesis?

• We have flexible platform technologies that can be applied to develop various types of mRNA drugs, including vaccines, therapeutic proteins, and gene therapies.
• We have an efficient delivery system that can enhance mRNA stability by optimizing the system through appropriate modifications of regulatory sequences.
• We have the ability to rapidly produce any target protein with a known sequence by synthesizing its mRNA in a very short time.

Publication Data

CD Formulation is dedicated to providing customers with mRNA synthesis services and offers a wide range of characterization techniques for these nucleic acid drugs. These services can be utilized holistically to assist customers in developing their projects in the drug therapy industry. If you are interested in our services, please get in touch with us.